Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   109491
Name   oriT_pSF149-5 in_silico
Organism   Shigella flexneri 7a strain 149
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_MW133280 (2240..2314 [+], 75 nt)
oriT length   75 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 75 nt

>oriT_pSF149-5
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   9926 GenBank   NZ_MW133280
Plasmid name   pSF149-5 Incompatibility group   ColRNAI
Plasmid size   2690 bp Coordinate of oriT [Strand]   2240..2314 [+]
Host baterium   Shigella flexneri 7a strain 149

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -