Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 109491
• Name: oriT_pSF149-5
• Organism: Shigella flexneri 7a strain 149
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_MW133280 (2240..2314 [+], 75 nt)
• oriT length: 75 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 75 nt

>oriT_pSF149-5
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 9926
• GenBank: NZ_MW133280
• Plasmid name: pSF149-5
• Incompatibility group: ColRNAI
• Plasmid size: 2690 bp
• Coordinate of oriT [Strand]: 2240..2314 [+]
• Host baterium: Shigella flexneri 7a strain 149

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -