Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 109191 |
| Name | oriT_pEk72-2  |
| Organism | Enterobacter kobei strain Ek72 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP088231 (851..909 [-], 59 nt) |
| oriT length | 59 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 59 nt
>oriT_pEk72-2
GGGTTCCGGGCGCAGCGCCGGACCAGTCACGCAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTCCGGGCGCAGCGCCGGACCAGTCACGCAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 9626 | GenBank | NZ_CP088231 |
| Plasmid name | pEk72-2 | Incompatibility group | ColRNAI |
| Plasmid size | 2495 bp | Coordinate of oriT [Strand] | 851..909 [-] |
| Host baterium | Enterobacter kobei strain Ek72 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |