Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 108952 |
| Name | oriT_pB-4549_2  |
| Organism | Salmonella enterica subsp. enterica serovar Hissar strain SCPM-O-B-4549 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP088140 (301..375 [+], 75 nt) |
| oriT length | 75 nt |
| IRs (inverted repeats) | 37..43, 46..52 (CGCGCAT..ATGCGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 75 nt
>oriT_pB-4549_2
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGCGCATGTATGCGCGGTATAACAATTACACATCCTGTC
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGCGCATGTATGCGCGGTATAACAATTACACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 9387 | GenBank | NZ_CP088140 |
| Plasmid name | pB-4549_2 | Incompatibility group | ColRNAI |
| Plasmid size | 8274 bp | Coordinate of oriT [Strand] | 301..375 [+] |
| Host baterium | Salmonella enterica subsp. enterica serovar Hissar strain SCPM-O-B-4549 |
Cargo genes
| Drug resistance gene | blaTEM-1B |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |