Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   108773
Name   oriT_pRPSZY in_silico
Organism   Rhodopseudomonas palustris
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_013548 (1588..1647 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pRPSZY
GGGTGTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   9208 GenBank   NC_013548
Plasmid name   pRPSZY Incompatibility group   Col440I
Plasmid size   2306 bp Coordinate of oriT [Strand]   1588..1647 [+]
Host baterium   Rhodopseudomonas palustris

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -