Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 108583 |
| Name | oriT_S92|unnamed2  |
| Organism | Ligilactobacillus salivarius strain S92 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP114545 (129236..129289 [-], 54 nt) |
| oriT length | 54 nt |
| IRs (inverted repeats) | 16..22, 28..34 (TCCCCAC..GTGGGGA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 54 nt
>oriT_S92|unnamed2
GTTGATACTGTCAACTCCCCACCGTGCGTGGGGACAGTTTTCCTTATGCTCTTT
GTTGATACTGTCAACTCCCCACCGTGCGTGGGGACAGTTTTCCTTATGCTCTTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 9018 | GenBank | NZ_CP114545 |
| Plasmid name | S92|unnamed2 | Incompatibility group | - |
| Plasmid size | 213661 bp | Coordinate of oriT [Strand] | 129236..129289 [-] |
| Host baterium | Ligilactobacillus salivarius strain S92 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIC1 |