Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   108568
Name   oriT_CHAL3|unnamed in_silico
Organism   Staphylococcus aureus strain CHAL3
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP125900 (15531..15721 [+], 191 nt)
oriT length   191 nt
IRs (inverted repeats)      135..140, 144..149  (TCTGGC..GCCAGA)
 4..11, 23..30  (CTTTTTTA..TAAAAAAG)
 16..21, 24..29  (TTTTTT..AAAAAA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 191 nt

>oriT_CHAL3|unnamed
TGTCTTTTTTATTGATTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGATCTGGCTTTGCCAGACCTATTATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   9003 GenBank   NZ_CP125900
Plasmid name   CHAL3|unnamed Incompatibility group   -
Plasmid size   31359 bp Coordinate of oriT [Strand]   15531..15721 [+]
Host baterium   Staphylococcus aureus strain CHAL3

Cargo genes


Drug resistance gene   blaZ
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21