Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   108489
Name   oriT_JB-1|p3 in_silico
Organism   Lactiplantibacillus plantarum strain JB-1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP097178 (2954..3090 [-], 137 nt)
oriT length   137 nt
IRs (inverted repeats)      21..28, 42..49  (AAAAGGGG..CCCCTTTT)
 25..30, 39..44  (GGGGAA..TTCCCC)
Location of nic site      104..105
Conserved sequence flanking the
  nic site  
 
 GCTTGCAGTA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 137 nt

>oriT_JB-1|p3
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCCACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATATGGTCCATTTTGTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   8924 GenBank   NZ_CP097178
Plasmid name   JB-1|p3 Incompatibility group   -
Plasmid size   9192 bp Coordinate of oriT [Strand]   2954..3090 [-]
Host baterium   Lactiplantibacillus plantarum strain JB-1

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -