Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   108487
Name   oriT_pAR0468_5 in_silico
Organism   Enterobacter asburiae strain AR0468-yvys
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP083839 (3395..3453 [-], 59 nt)
oriT length   59 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 59 nt

>oriT_pAR0468_5
GGTTTCGGGGCGCAGCCCTGAACCAGTCACCTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   8922 GenBank   NZ_CP083839
Plasmid name   pAR0468_5 Incompatibility group   Col440II
Plasmid size   5933 bp Coordinate of oriT [Strand]   3395..3453 [-]
Host baterium   Enterobacter asburiae strain AR0468-yvys

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -