Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   108477
Name   oriT_KUFSE-SAL0043|unnamed in_silico
Organism   Salmonella enterica subsp. enterica serovar Dessau strain KUFSE-SAL0043
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP047425 (9237..9296 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_KUFSE-SAL0043|unnamed
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   8912 GenBank   NZ_CP047425
Plasmid name   KUFSE-SAL0043|unnamed Incompatibility group   ColRNAI
Plasmid size   17726 bp Coordinate of oriT [Strand]   9237..9296 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Dessau strain KUFSE-SAL0043

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   arsC, arsB, arsR, arsH
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -