Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   108475
Name   oriT_pSAU749 in_silico
Organism   Staphylococcus aureus strain Guangzhou-SAU749
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP053186 (12691..12930 [-], 240 nt)
oriT length   240 nt
IRs (inverted repeats)      217..222, 232..237  (ATTTTA..TAAAAT)
 171..178, 183..190  (CTATCATT..AATGATAG)
 154..160, 164..170  (GTCTGGC..GCCAGAC)
 26..32, 44..50  (TTTTTTA..TAAAAAA)
 37..42, 45..50  (TTTTTT..AAAAAA)
 1..7, 20..26  (AAGACAT..ATGTCTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 240 nt

>oriT_pSAU749
AAGACATTAGTGATAACTGATGTCTTTTTTTATTGATTTTTTGTAAAAAAGTACTGTCTTAGTTTTGTGACAAATACTGTATATAGTGTCACAAAAGTGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   8910 GenBank   NZ_CP053186
Plasmid name   pSAU749 Incompatibility group   -
Plasmid size   20736 bp Coordinate of oriT [Strand]   12691..12930 [-]
Host baterium   Staphylococcus aureus strain Guangzhou-SAU749

Cargo genes


Drug resistance gene   blaZ
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21