Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 108391
• Name: oriT_pAT45b-c
• Organism: Enterococcus faecium strain AT45b
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP097025 (2934..3034 [-], 101 nt)
• oriT length: 101 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 101 nt

>oriT_pAT45b-c
TCATCTGCCGAAACTTTGAATATGAGTGTGCCGACTTTCGTTAAGAAAAAGGCACAAGGCAGTCGATTGGTAGCGCCCAAATTAGATAAAGAGACGCGACA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 8826
• GenBank: NZ_CP097025
• Plasmid name: pAT45b-c
• Incompatibility group: -
• Plasmid size: 23514 bp
• Coordinate of oriT [Strand]: 2934..3034 [-]
• Host baterium: Enterococcus faecium strain AT45b

Cargo genes

• Drug resistance gene: cat(pC233), erm(B), ant(6)-Ia, aph(3')-III
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: AcrIIA21