Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 108375
• Name: oriT_pYUXJMC1-7
• Organism: Escherichia fergusonii strain XJ19MCE1
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP125357 (1154..1226 [+], 73 nt)
• oriT length: 73 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 73 nt

>oriT_pYUXJMC1-7
GTCGGGGTGAAGCCCTGACCAGGTGGGGAATGTCTGAGTGCGCGTGCGCGGTCCGACATTCCCACATCCTGTC

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 8810
• GenBank: NZ_CP125357
• Plasmid name: pYUXJMC1-7
• Incompatibility group: Col
• Plasmid size: 1546 bp
• Coordinate of oriT [Strand]: 1154..1226 [+]
• Host baterium: Escherichia fergusonii strain XJ19MCE1

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -