Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   108375
Name   oriT_pYUXJMC1-7 in_silico
Organism   Escherichia fergusonii strain XJ19MCE1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP125357 (1154..1226 [+], 73 nt)
oriT length   73 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 73 nt

>oriT_pYUXJMC1-7
GTCGGGGTGAAGCCCTGACCAGGTGGGGAATGTCTGAGTGCGCGTGCGCGGTCCGACATTCCCACATCCTGTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   8810 GenBank   NZ_CP125357
Plasmid name   pYUXJMC1-7 Incompatibility group   Col
Plasmid size   1546 bp Coordinate of oriT [Strand]   1154..1226 [+]
Host baterium   Escherichia fergusonii strain XJ19MCE1

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -