Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   108371
Name   oriT_pYUXJMC1-3 in_silico
Organism   Escherichia fergusonii strain XJ19MCE1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP125353 (34984..35068 [-], 85 nt)
oriT length   85 nt
IRs (inverted repeats)      63..68, 75..80  (AAAAAA..TTTTTT)
 63..68, 74..79  (AAAAAA..TTTTTT)
 17..24, 27..34  (AGCGTGAT..ATCACGCT)
 12..17, 26..31  (GTGATA..TATCAC)
 3..9, 21..27  (TAAATCA..TGATTTA)
Location of nic site      45..46
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 85 nt

>oriT_pYUXJMC1-3
TTTAAATCAGTGTGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   8806 GenBank   NZ_CP125353
Plasmid name   pYUXJMC1-3 Incompatibility group   IncFIB
Plasmid size   39025 bp Coordinate of oriT [Strand]   34984..35068 [-]
Host baterium   Escherichia fergusonii strain XJ19MCE1

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -