Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 108371 |
Name | oriT_pYUXJMC1-3 |
Organism | Escherichia fergusonii strain XJ19MCE1 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP125353 (34984..35068 [-], 85 nt) |
oriT length | 85 nt |
IRs (inverted repeats) | 63..68, 75..80 (AAAAAA..TTTTTT) 63..68, 74..79 (AAAAAA..TTTTTT) 17..24, 27..34 (AGCGTGAT..ATCACGCT) 12..17, 26..31 (GTGATA..TATCAC) 3..9, 21..27 (TAAATCA..TGATTTA) |
Location of nic site | 45..46 |
Conserved sequence flanking the nic site |
GGTGTATAGC |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 85 nt
>oriT_pYUXJMC1-3
TTTAAATCAGTGTGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTAAATCAGTGTGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 8806 | GenBank | NZ_CP125353 |
Plasmid name | pYUXJMC1-3 | Incompatibility group | IncFIB |
Plasmid size | 39025 bp | Coordinate of oriT [Strand] | 34984..35068 [-] |
Host baterium | Escherichia fergusonii strain XJ19MCE1 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |