Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 108337 |
| Name | oriT_pSD21_4kb  |
| Organism | Enterobacter cloacae strain SD21 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP093918 (4502..4553 [+], 52 nt) |
| oriT length | 52 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 52 nt
>oriT_pSD21_4kb
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 8772 | GenBank | NZ_CP093918 |
| Plasmid name | pSD21_4kb | Incompatibility group | ColRNAI |
| Plasmid size | 4991 bp | Coordinate of oriT [Strand] | 4502..4553 [+] |
| Host baterium | Enterobacter cloacae strain SD21 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |