Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 108151 |
| Name | oriT_J57|unnamed1  |
| Organism | Klebsiella variicola strain J57 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP124805 (160864..160913 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_J57|unnamed1
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 8586 | GenBank | NZ_CP124805 |
| Plasmid name | J57|unnamed1 | Incompatibility group | IncFIB |
| Plasmid size | 174299 bp | Coordinate of oriT [Strand] | 160864..160913 [+] |
| Host baterium | Klebsiella variicola strain J57 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | fecE, fecD, silE, silS, silR, silC, silF, silB, silA, silP, pcoA, pcoB, pcoC, pcoD, pcoR, pcoS, pcoE, arsC, arsB, arsA, arsD, arsR, merR2, merT, merP, merF, merA, merD, merE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |