Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 108139 |
Name | oriT_CF12|unnamed2 |
Organism | Citrobacter freundii strain CF12 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP124816 (39909..40007 [+], 99 nt) |
oriT length | 99 nt |
IRs (inverted repeats) | 77..82, 89..94 (AAAAAA..TTTTTT) 77..82, 88..93 (AAAAAA..TTTTTT) 31..38, 41..48 (AGCGTGAT..ATCACGCT) 17..23, 35..41 (TAAATCA..TGATTTA) |
Location of nic site | 59..60 |
Conserved sequence flanking the nic site |
GGTGTATAGC |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 99 nt
>oriT_CF12|unnamed2
TTTGTTTTTTTTCTTTTAAATCAGTGCAATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTGTTTTTTTTCTTTTAAATCAGTGCAATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 8574 | GenBank | NZ_CP124816 |
Plasmid name | CF12|unnamed2 | Incompatibility group | IncR |
Plasmid size | 41037 bp | Coordinate of oriT [Strand] | 39909..40007 [+] |
Host baterium | Citrobacter freundii strain CF12 |
Cargo genes
Drug resistance gene | aph(6)-Id, aph(3'')-Ib, tet(B), blaTEM-1B |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |