Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 108019 |
| Name | oriT_pVB6171_p8  |
| Organism | Enterococcus faecium strain VB6171 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP072739 (1437..1487 [+], 51 nt) |
| oriT length | 51 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 51 nt
>oriT_pVB6171_p8
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 8454 | GenBank | NZ_CP072739 |
| Plasmid name | pVB6171_p8 | Incompatibility group | - |
| Plasmid size | 2574 bp | Coordinate of oriT [Strand] | 1437..1487 [+] |
| Host baterium | Enterococcus faecium strain VB6171 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |