Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   108016
Name   oriT_pVB6521_p8 in_silico
Organism   Enterococcus faecium strain VB6521
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP072728 (1437..1487 [+], 51 nt)
oriT length   51 nt
IRs (inverted repeats)      6..13, 16..23  (GCAAAATT..AATTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 51 nt

>oriT_pVB6521_p8
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   8451 GenBank   NZ_CP072728
Plasmid name   pVB6521_p8 Incompatibility group   -
Plasmid size   2574 bp Coordinate of oriT [Strand]   1437..1487 [+]
Host baterium   Enterococcus faecium strain VB6521

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -