Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107997 |
| Name | oriT_KF140|unnamed3  |
| Organism | Lactococcus lactis strain KF140 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP070385 (1936..2072 [-], 137 nt) |
| oriT length | 137 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | 104..105 |
| Conserved sequence flanking the nic site |
GCTTGCAGTA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 137 nt
>oriT_KF140|unnamed3
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCTCCTTTTCAAGCAACATTGTAATACAAGAACGAAGTGATTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATATGGTCTATTTTGTT
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCTCCTTTTCAAGCAACATTGTAATACAAGAACGAAGTGATTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATATGGTCTATTTTGTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 8432 | GenBank | NZ_CP070385 |
| Plasmid name | KF140|unnamed3 | Incompatibility group | - |
| Plasmid size | 6833 bp | Coordinate of oriT [Strand] | 1936..2072 [-] |
| Host baterium | Lactococcus lactis strain KF140 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |