Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107985 |
| Name | oriT_p199  |
| Organism | Staphylococcus aureus strain OS-MRSA 199 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_OL689185 (174..361 [+], 188 nt) |
| oriT length | 188 nt |
| IRs (inverted repeats) | 162..167, 177..182 (ATTTTA..TAAAAT) 117..122, 129..134 (CCCCAT..ATGGGG) 99..105, 109..115 (ATCTGGC..GCCAGAT) 40..45, 47..52 (AAGTGT..ACACTT) 30..38, 43..51 (AGTGTCACA..TGTGACACT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 188 nt
>oriT_p199
TGTCTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTTGAGCTTTTTATGACCCCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
TGTCTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTTGAGCTTTTTATGACCCCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 8420 | GenBank | NZ_OL689185 |
| Plasmid name | p199 | Incompatibility group | - |
| Plasmid size | 23998 bp | Coordinate of oriT [Strand] | 174..361 [+] |
| Host baterium | Staphylococcus aureus strain OS-MRSA 199 |
Cargo genes
| Drug resistance gene | blaZ |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |