Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   107985
Name   oriT_p199 in_silico
Organism   Staphylococcus aureus strain OS-MRSA 199
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_OL689185 (174..361 [+], 188 nt)
oriT length   188 nt
IRs (inverted repeats)      162..167, 177..182  (ATTTTA..TAAAAT)
 117..122, 129..134  (CCCCAT..ATGGGG)
 99..105, 109..115  (ATCTGGC..GCCAGAT)
 40..45, 47..52  (AAGTGT..ACACTT)
 30..38, 43..51  (AGTGTCACA..TGTGACACT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 188 nt

>oriT_p199
TGTCTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTTGAGCTTTTTATGACCCCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   8420 GenBank   NZ_OL689185
Plasmid name   p199 Incompatibility group   -
Plasmid size   23998 bp Coordinate of oriT [Strand]   174..361 [+]
Host baterium   Staphylococcus aureus strain OS-MRSA 199

Cargo genes


Drug resistance gene   blaZ
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -