Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   107983
Name   oriT_sau697|unnamed in_silico
Organism   Staphylococcus aureus strain sau697
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_OL689186 (19759..19998 [+], 240 nt)
oriT length   240 nt
IRs (inverted repeats)      217..222, 232..237  (ATTTTA..TAAAAT)
 171..178, 183..190  (CTATCATT..AATGATAG)
 154..160, 164..170  (GTCTGGC..GCCAGAC)
 26..32, 44..50  (TTTTTTA..TAAAAAA)
 37..42, 45..50  (TTTTTT..AAAAAA)
 1..7, 20..26  (AAGACAT..ATGTCTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 240 nt

>oriT_sau697|unnamed
AAGACATTAGTGATAACTGATGTCTTTTTTTATTGATTTTTTGTAAAAAAGTACTGTCTTAGTTTTGTGACAAATACTGTATATAGTGTCACAAAAGTGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   8418 GenBank   NZ_OL689186
Plasmid name   sau697|unnamed Incompatibility group   -
Plasmid size   20691 bp Coordinate of oriT [Strand]   19759..19998 [+]
Host baterium   Staphylococcus aureus strain sau697

Cargo genes


Drug resistance gene   blaZ
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21