Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107963 |
| Name | oriT_pR39-8  |
| Organism | Providencia rettgeri strain R39 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP066317 (2917..3076 [-], 160 nt) |
| oriT length | 160 nt |
| IRs (inverted repeats) | 39..44, 48..53 (CCCTAC..GTAGGG) 6..12, 16..22 (GTTTCTC..GAGAAAC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 160 nt
>oriT_pR39-8
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGTCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGTCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 8398 | GenBank | NZ_CP066317 |
| Plasmid name | pR39-8 | Incompatibility group | IncQ1 |
| Plasmid size | 8234 bp | Coordinate of oriT [Strand] | 2917..3076 [-] |
| Host baterium | Providencia rettgeri strain R39 |
Cargo genes
| Drug resistance gene | floR |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |