Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   107958
Name   oriT_pCAVP450-8132 in_silico
Organism   Providencia stuartii strain CAVP450
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP119554 (5255..5414 [-], 160 nt)
oriT length   160 nt
IRs (inverted repeats)      39..44, 48..53  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 160 nt

>oriT_pCAVP450-8132
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   8393 GenBank   NZ_CP119554
Plasmid name   pCAVP450-8132 Incompatibility group   IncQ1
Plasmid size   8132 bp Coordinate of oriT [Strand]   5255..5414 [-]
Host baterium   Providencia stuartii strain CAVP450

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -