Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107891 |
| Name | oriT_pJBIWA005_7 |
| Organism | Enterobacter sp. JBIWA005 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP074166 (4077..4134 [-], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | 29..36, 39..46 (CACAGCGT..ACGCTGTG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_pJBIWA005_7
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACAGCGTTTACGCTGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACAGCGTTTACGCTGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 8326 | GenBank | NZ_CP074166 |
| Plasmid name | pJBIWA005_7 | Incompatibility group | ColRNAI |
| Plasmid size | 6036 bp | Coordinate of oriT [Strand] | 4077..4134 [-] |
| Host baterium | Enterobacter sp. JBIWA005 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |