Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107888 |
| Name | oriT_pJBIWA003_5  |
| Organism | Enterobacter sp. JBIWA003 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP074175 (282..340 [-], 59 nt) |
| oriT length | 59 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 59 nt
>oriT_pJBIWA003_5
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 8323 | GenBank | NZ_CP074175 |
| Plasmid name | pJBIWA003_5 | Incompatibility group | Col440II |
| Plasmid size | 5940 bp | Coordinate of oriT [Strand] | 282..340 [-] |
| Host baterium | Enterobacter sp. JBIWA003 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |