Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   107888
Name   oriT_pJBIWA003_5 in_silico
Organism   Enterobacter sp. JBIWA003
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP074175 (282..340 [-], 59 nt)
oriT length   59 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 59 nt

>oriT_pJBIWA003_5
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   8323 GenBank   NZ_CP074175
Plasmid name   pJBIWA003_5 Incompatibility group   Col440II
Plasmid size   5940 bp Coordinate of oriT [Strand]   282..340 [-]
Host baterium   Enterobacter sp. JBIWA003

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -