Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107884 |
| Name | oriT_pJBIWA001_11  |
| Organism | Raoultella planticola strain JBIWA001 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP074193 (669..724 [+], 56 nt) |
| oriT length | 56 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 56 nt
>oriT_pJBIWA001_11
GGGTTTCGGGGCGAAGCCCTGAACCAGTCACTCCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGAAGCCCTGAACCAGTCACTCCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 8319 | GenBank | NZ_CP074193 |
| Plasmid name | pJBIWA001_11 | Incompatibility group | - |
| Plasmid size | 1610 bp | Coordinate of oriT [Strand] | 669..724 [+] |
| Host baterium | Raoultella planticola strain JBIWA001 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |