Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107879 |
| Name | oriT_pJBIWA001_4  |
| Organism | Raoultella planticola strain JBIWA001 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP074186 (70660..70709 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..13, 18..24 (GCAAAAT..ATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pJBIWA001_4
AAATCTGCAAAATATTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATATTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 8314 | GenBank | NZ_CP074186 |
| Plasmid name | pJBIWA001_4 | Incompatibility group | IncFIB |
| Plasmid size | 102491 bp | Coordinate of oriT [Strand] | 70660..70709 [+] |
| Host baterium | Raoultella planticola strain JBIWA001 |
Cargo genes
| Drug resistance gene | aac(6')-Ib-cr, ARR-3, dfrA27, aadA16, qacE, sul1, qnrB91, mph(A) |
| Virulence gene | - |
| Metal resistance gene | merE, merD, merA, merP, merT, arsC, arsB, arsA, arsD, arsR |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |