Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107876 |
| Name | oriT_pSY333-7  |
| Organism | Staphylococcus caprae strain SY333 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP051646 (389..509 [-], 121 nt) |
| oriT length | 121 nt |
| IRs (inverted repeats) | 53..60, 62..69 (TTGGGGAT..ATCCCCAA) 22..29, 34..41 (ATTTTTTC..GAAAAAAT) 1..8, 14..21 (AGTGGCTA..TAGCCACT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 121 nt
>oriT_pSY333-7
AGTGGCTAGCAATTAGCCACTATTTTTTCGTCAGAAAAAATCCATAAGGGGCTTGGGGATTATCCCCAACAAGCTGGCGCGTCTGCCACGTCAGTGGCTAGCAAAGCCAATGCTTGCCAAA
AGTGGCTAGCAATTAGCCACTATTTTTTCGTCAGAAAAAATCCATAAGGGGCTTGGGGATTATCCCCAACAAGCTGGCGCGTCTGCCACGTCAGTGGCTAGCAAAGCCAATGCTTGCCAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 8311 | GenBank | NZ_CP051646 |
| Plasmid name | pSY333-7 | Incompatibility group | - |
| Plasmid size | 7385 bp | Coordinate of oriT [Strand] | 389..509 [-] |
| Host baterium | Staphylococcus caprae strain SY333 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |