Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   107847
Name   oriT_p4C12 in_silico
Organism   Citrobacter freundii strain IDR1900015725-01-02
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP054281 (2019..2078 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_p4C12
GGGTGTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   8282 GenBank   NZ_CP054281
Plasmid name   p4C12 Incompatibility group   Col440I
Plasmid size   12137 bp Coordinate of oriT [Strand]   2019..2078 [-]
Host baterium   Citrobacter freundii strain IDR1900015725-01-02

Cargo genes


Drug resistance gene   blaKPC-2
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -