Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   107844
Name   oriT_p1C2 in_silico
Organism   Citrobacter freundii strain IDR1800045912-01-00
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP054300 (1095..1154 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_p1C2
GGGTGTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   8279 GenBank   NZ_CP054300
Plasmid name   p1C2 Incompatibility group   Col440I
Plasmid size   2155 bp Coordinate of oriT [Strand]   1095..1154 [+]
Host baterium   Citrobacter freundii strain IDR1800045912-01-00

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -