Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   107840
Name   oriT_pJD053-3K in_silico
Organism   Escherichia fergusonii strain EF21JD053
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP095793 (357..431 [+], 75 nt)
oriT length   75 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 75 nt

>oriT_pJD053-3K
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   8275 GenBank   NZ_CP095793
Plasmid name   pJD053-3K Incompatibility group   ColRNAI
Plasmid size   3003 bp Coordinate of oriT [Strand]   357..431 [+]
Host baterium   Escherichia fergusonii strain EF21JD053

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -