Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 107840
• Name: oriT_pJD053-3K
• Organism: Escherichia fergusonii strain EF21JD053
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP095793 (357..431 [+], 75 nt)
• oriT length: 75 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 75 nt

>oriT_pJD053-3K
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 8275
• GenBank: NZ_CP095793
• Plasmid name: pJD053-3K
• Incompatibility group: ColRNAI
• Plasmid size: 3003 bp
• Coordinate of oriT [Strand]: 357..431 [+]
• Host baterium: Escherichia fergusonii strain EF21JD053

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -