Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   107828
Name   oriT_FAM24675|unnamed2 in_silico
Organism   Morganella morganii strain FAM24675
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP066135 (707..764 [-], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_FAM24675|unnamed2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   8263 GenBank   NZ_CP066135
Plasmid name   FAM24675|unnamed2 Incompatibility group   ColRNAI
Plasmid size   3186 bp Coordinate of oriT [Strand]   707..764 [-]
Host baterium   Morganella morganii strain FAM24675

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -