Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107806 |
| Name | oriT_Effluent_4|unnamed2  |
| Organism | Enterobacter cloacae strain Effluent_4 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP039308 (4292..4349 [+], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_Effluent_4|unnamed2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATAATGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATAATGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 8241 | GenBank | NZ_CP039308 |
| Plasmid name | Effluent_4|unnamed2 | Incompatibility group | Col440II |
| Plasmid size | 5134 bp | Coordinate of oriT [Strand] | 4292..4349 [+] |
| Host baterium | Enterobacter cloacae strain Effluent_4 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |