Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107798 |
| Name | oriT_FDAARGOS_365|unnamed  |
| Organism | Morganella morganii strain FDAARGOS_365 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP023506 (963..1049 [-], 87 nt) |
| oriT length | 87 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 87 nt
>oriT_FDAARGOS_365|unnamed
GGGGTGTCGGGGTGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT
GGGGTGTCGGGGTGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 8233 | GenBank | NZ_CP023506 |
| Plasmid name | FDAARGOS_365|unnamed | Incompatibility group | Col |
| Plasmid size | 1509 bp | Coordinate of oriT [Strand] | 963..1049 [-] |
| Host baterium | Morganella morganii strain FDAARGOS_365 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |