Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107735 |
| Name | oriT_pGTAFD2016-MI-0253.2  |
| Organism | Salmonella enterica subsp. enterica serovar Senftenberg strain CFIAFB20170121 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP038610 (2922..2981 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pGTAFD2016-MI-0253.2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 8170 | GenBank | NZ_CP038610 |
| Plasmid name | pGTAFD2016-MI-0253.2 | Incompatibility group | Col440I |
| Plasmid size | 4018 bp | Coordinate of oriT [Strand] | 2922..2981 [-] |
| Host baterium | Salmonella enterica subsp. enterica serovar Senftenberg strain CFIAFB20170121 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |