Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   107734
Name   oriT_p12-2388.5 in_silico
Organism   Salmonella enterica subsp. enterica serovar Hadar strain 12-2388
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP038600 (603..685 [-], 83 nt)
oriT length   83 nt
IRs (inverted repeats)      1..6, 15..20  (GGGGTG..CACCCC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 83 nt

>oriT_p12-2388.5
GGGGTGTCGGGGTGCACCCCTGACCAGATGGCAATTGTGATAGCGTCGCGTGTGACGGTATTACAATTACACATCCTGTCCCG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   8169 GenBank   NZ_CP038600
Plasmid name   p12-2388.5 Incompatibility group   ColpVC
Plasmid size   2097 bp Coordinate of oriT [Strand]   603..685 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Hadar strain 12-2388

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -