Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   107726
Name   oriT_FDAARGOS_47|unnamed in_silico
Organism   Staphylococcus aureus strain FDAARGOS_47
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP026075 (5938..6127 [-], 190 nt)
oriT length   190 nt
IRs (inverted repeats)      133..139, 143..149  (GTCTGGC..GCCAGAC)
 4..11, 23..30  (CTTTTTTA..TAAAAAAG)
 16..21, 24..29  (TTTTTT..AAAAAA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 190 nt

>oriT_FDAARGOS_47|unnamed
TGTCTTTTTTATTGATTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATTATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   8161 GenBank   NZ_CP026075
Plasmid name   FDAARGOS_47|unnamed Incompatibility group   -
Plasmid size   23690 bp Coordinate of oriT [Strand]   5938..6127 [-]
Host baterium   Staphylococcus aureus strain FDAARGOS_47

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   merB, merA, merR, cadC
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21