Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   107643
Name   oriT_FDAARGOS 1424|unnamed1 in_silico
Organism   Citrobacter pasteurii strain FDAARGOS 1424
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP077261 (3265..3324 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_FDAARGOS 1424|unnamed1
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGCAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   8078 GenBank   NZ_CP077261
Plasmid name   FDAARGOS 1424|unnamed1 Incompatibility group   Col440II
Plasmid size   6827 bp Coordinate of oriT [Strand]   3265..3324 [+]
Host baterium   Citrobacter pasteurii strain FDAARGOS 1424

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -