Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107622 |
| Name | oriT1_LY-1|unnamed1  |
| Organism | Citrobacter arsenatis strain LY-1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP037862 ( 112..171 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT1_LY-1|unnamed1
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACAGTGCGCTAGCGCTGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACAGTGCGCTAGCGCTGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 8057 | GenBank | NZ_CP037862 |
| Plasmid name | LY-1|unnamed1 | Incompatibility group | ColRNAI |
| Plasmid size | 15855 bp | Coordinate of oriT [Strand] | 8420..8479 [-]; 112..171 [-] |
| Host baterium | Citrobacter arsenatis strain LY-1 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |