Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   107616
Name   oriT_pTmo1 in_silico
Organism   Tatumella morbirosei strain LMG 23360
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CM003276 (1179..1236 [-], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_pTmo1
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATATTGGCTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   8051 GenBank   NZ_CM003276
Plasmid name   pTmo1 Incompatibility group   Col440I
Plasmid size   5657 bp Coordinate of oriT [Strand]   1179..1236 [-]
Host baterium   Tatumella morbirosei strain LMG 23360

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -