Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107616 |
| Name | oriT_pTmo1  |
| Organism | Tatumella morbirosei strain LMG 23360 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CM003276 (1179..1236 [-], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_pTmo1
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATATTGGCTT
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATATTGGCTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 8051 | GenBank | NZ_CM003276 |
| Plasmid name | pTmo1 | Incompatibility group | Col440I |
| Plasmid size | 5657 bp | Coordinate of oriT [Strand] | 1179..1236 [-] |
| Host baterium | Tatumella morbirosei strain LMG 23360 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |