Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   107613
Name   oriT_pSH1275-3 in_silico
Organism   Staphylococcus haemolyticus strain SH1275
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP123982 (434..554 [-], 121 nt)
oriT length   121 nt
IRs (inverted repeats)      53..59, 63..69  (TTGGGGA..TCCCCAA)
 23..29, 36..42  (ATTTTTT..AAAAAAT)
 24..30, 34..40  (TTTTTTC..GAAAAAA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 121 nt

>oriT_pSH1275-3
AGTGGCTAGCAATTAGACACTTATTTTTTCGCAGAAAAAAATCCTAAGGGGCTTGGGGATATTCCCCAACAAGCAGGCGTCGCTACCACGTATGTGGCTAGCAAAGCCAATGCTTGCCAAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   8048 GenBank   NZ_CP123982
Plasmid name   pSH1275-3 Incompatibility group   -
Plasmid size   6056 bp Coordinate of oriT [Strand]   434..554 [-]
Host baterium   Staphylococcus haemolyticus strain SH1275

Cargo genes


Drug resistance gene   vga(A)LC
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -