Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107613 |
| Name | oriT_pSH1275-3  |
| Organism | Staphylococcus haemolyticus strain SH1275 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP123982 (434..554 [-], 121 nt) |
| oriT length | 121 nt |
| IRs (inverted repeats) | 53..59, 63..69 (TTGGGGA..TCCCCAA) 23..29, 36..42 (ATTTTTT..AAAAAAT) 24..30, 34..40 (TTTTTTC..GAAAAAA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 121 nt
>oriT_pSH1275-3
AGTGGCTAGCAATTAGACACTTATTTTTTCGCAGAAAAAAATCCTAAGGGGCTTGGGGATATTCCCCAACAAGCAGGCGTCGCTACCACGTATGTGGCTAGCAAAGCCAATGCTTGCCAAA
AGTGGCTAGCAATTAGACACTTATTTTTTCGCAGAAAAAAATCCTAAGGGGCTTGGGGATATTCCCCAACAAGCAGGCGTCGCTACCACGTATGTGGCTAGCAAAGCCAATGCTTGCCAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 8048 | GenBank | NZ_CP123982 |
| Plasmid name | pSH1275-3 | Incompatibility group | - |
| Plasmid size | 6056 bp | Coordinate of oriT [Strand] | 434..554 [-] |
| Host baterium | Staphylococcus haemolyticus strain SH1275 |
Cargo genes
| Drug resistance gene | vga(A)LC |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |