Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107606 |
| Name | oriT_pSF45436a |
| Organism | Sinorhizobium fredii CCBAU 45436 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP029233 (42192..42248 [-], 57 nt) |
| oriT length | 57 nt |
| IRs (inverted repeats) | 4..9, 23..28 (GGAAAA..TTTTCC) 6..11, 20..25 (AAAATG..CATTTT) |
| Location of nic site | 36..37 |
| Conserved sequence flanking the nic site |
TCCTGCCCCT |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 57 nt
>oriT_pSF45436a
GCAGGAAAATGGCGTAGCACATTTTTCCGTATCCTGCCCCTCTAAATTGTAAGGGGA
GCAGGAAAATGGCGTAGCACATTTTTCCGTATCCTGCCCCTCTAAATTGTAAGGGGA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 407463..416535
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| AB395_RS31875 (AB395_00004616) | 402625..402918 | + | 294 | Protein_399 | helix-turn-helix domain-containing protein | - |
| AB395_RS31880 (AB395_00004617) | 402941..403153 | - | 213 | WP_014858049 | DUF5372 family protein | - |
| AB395_RS31885 | 403249..403506 | + | 258 | Protein_401 | IS21 family transposase | - |
| AB395_RS31890 | 403547..403777 | + | 231 | Protein_402 | AAA family ATPase | - |
| AB395_RS31895 | 403913..404146 | - | 234 | WP_010875417 | helix-turn-helix transcriptional regulator | - |
| AB395_RS31900 (AB395_00004620) | 404365..404688 | + | 324 | WP_014858045 | transcriptional repressor TraM | - |
| AB395_RS31905 | 404692..405404 | - | 713 | Protein_405 | autoinducer binding domain-containing protein | - |
| AB395_RS31910 (AB395_00004624) | 405707..407001 | - | 1295 | Protein_406 | IncP-type conjugal transfer protein TrbI | - |
| AB395_RS31915 (AB395_00004625) | 407013..407459 | - | 447 | WP_014858040 | conjugal transfer protein TrbH | - |
| AB395_RS31920 (AB395_00004626) | 407463..408275 | - | 813 | WP_014858039 | P-type conjugative transfer protein TrbG | virB9 |
| AB395_RS31925 (AB395_00004627) | 408293..408955 | - | 663 | WP_014858038 | conjugal transfer protein TrbF | virB8 |
| AB395_RS31930 (AB395_00004628) | 408979..410154 | - | 1176 | WP_034859627 | P-type conjugative transfer protein TrbL | virB6 |
| AB395_RS31935 (AB395_00004629) | 410148..410345 | - | 198 | WP_014858036 | entry exclusion protein TrbK | - |
| AB395_RS31940 (AB395_00004630) | 410342..411145 | - | 804 | WP_014858035 | P-type conjugative transfer protein TrbJ | virB5 |
| AB395_RS31945 (AB395_00004631) | 411117..413348 | - | 2232 | Protein_413 | conjugal transfer protein TrbE | - |
| AB395_RS31950 (AB395_00004632) | 413427..414449 | + | 1023 | WP_014328393 | IS110 family transposase | - |
| AB395_RS31955 (AB395_00004633) | 414649..414882 | - | 234 | WP_014858033 | hypothetical protein | virb4 |
| AB395_RS31960 (AB395_00004634) | 414893..415192 | - | 300 | WP_010875429 | conjugal transfer protein TrbD | virB3 |
| AB395_RS31965 (AB395_00004635) | 415185..415568 | - | 384 | WP_034859524 | TrbC/VirB2 family protein | virB2 |
| AB395_RS31970 (AB395_00004636) | 415558..416535 | - | 978 | WP_015633597 | P-type conjugative transfer ATPase TrbB | virB11 |
| AB395_RS31975 (AB395_00004638) | 416546..417172 | - | 627 | WP_014858030 | acyl-homoserine-lactone synthase | - |
Host bacterium
| ID | 8041 | GenBank | NZ_CP029233 |
| Plasmid name | pSF45436a | Incompatibility group | - |
| Plasmid size | 418014 bp | Coordinate of oriT [Strand] | 42192..42248 [-] |
| Host baterium | Sinorhizobium fredii CCBAU 45436 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | nodA, nodB, nodC, nodI, nodJ, nifS, fixU, nifZ, nifB, fixX, fixC, fixB, fixA, nifH, nifD, nifK, nifE, nifX, nodD, nodZ, nolV, nolU, nolT, nopB, nolW, nolX, mLTONO_5203 |
| Anti-CRISPR | AcrIC6 |