Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107599 |
| Name | oriT_pRmeGR4b  |
| Organism | Sinorhizobium meliloti GR4 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_019847 (111349..111405 [-], 57 nt) |
| oriT length | 57 nt |
| IRs (inverted repeats) | 4..9, 23..28 (GGAAAA..TTTTCC) |
| Location of nic site | 36..37 |
| Conserved sequence flanking the nic site |
TCCTGCCTCT |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 57 nt
>oriT_pRmeGR4b
GCAGGAAAAGGGCGTAGCACATTTTTCCGTATCCTGCCTCTCCAAATTGTAAGGGGA
GCAGGAAAAGGGCGTAGCACATTTTTCCGTATCCTGCCTCTCCAAATTGTAAGGGGA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 8034 | GenBank | NC_019847 |
| Plasmid name | pRmeGR4b | Incompatibility group | - |
| Plasmid size | 225725 bp | Coordinate of oriT [Strand] | 111349..111405 [-] |
| Host baterium | Sinorhizobium meliloti GR4 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | htpB |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |