Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   107563
Name   oriT_pUR2355 in_silico
Organism   Staphylococcus aureus
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_019145 (1722..1827 [-], 106 nt)
oriT length   106 nt
IRs (inverted repeats)      53..59, 63..69  (TTGGGGA..TCCCCAA)
 23..29, 36..42  (ATTTTTT..AAAAAAT)
 24..30, 34..40  (TTTTTTC..GAAAAAA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 106 nt

>oriT_pUR2355
AGTGGCTAGCAATTAGACACTTATTTTTTCGCAGAAAAAAATCCTAAGGGGCTTGGGGATATTCCCCAACAAGCAGGCGTCGCTACCACGTATGTGGCTAGCCAAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7998 GenBank   NC_019145
Plasmid name   pUR2355 Incompatibility group   -
Plasmid size   7609 bp Coordinate of oriT [Strand]   1722..1827 [-]
Host baterium   Staphylococcus aureus

Cargo genes


Drug resistance gene   vga(A)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -