Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107563 |
| Name | oriT_pUR2355  |
| Organism | Staphylococcus aureus |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_019145 (1722..1827 [-], 106 nt) |
| oriT length | 106 nt |
| IRs (inverted repeats) | 53..59, 63..69 (TTGGGGA..TCCCCAA) 23..29, 36..42 (ATTTTTT..AAAAAAT) 24..30, 34..40 (TTTTTTC..GAAAAAA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 106 nt
>oriT_pUR2355
AGTGGCTAGCAATTAGACACTTATTTTTTCGCAGAAAAAAATCCTAAGGGGCTTGGGGATATTCCCCAACAAGCAGGCGTCGCTACCACGTATGTGGCTAGCCAAA
AGTGGCTAGCAATTAGACACTTATTTTTTCGCAGAAAAAAATCCTAAGGGGCTTGGGGATATTCCCCAACAAGCAGGCGTCGCTACCACGTATGTGGCTAGCCAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 7998 | GenBank | NC_019145 |
| Plasmid name | pUR2355 | Incompatibility group | - |
| Plasmid size | 7609 bp | Coordinate of oriT [Strand] | 1722..1827 [-] |
| Host baterium | Staphylococcus aureus |
Cargo genes
| Drug resistance gene | vga(A) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |