Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107555 |
| Name | oriT_pSA1308  |
| Organism | Staphylococcus aureus |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_007928 (1042..1228 [+], 187 nt) |
| oriT length | 187 nt |
| IRs (inverted repeats) | 99..106, 110..117 (TATCTGGC..GCCAGATA) 55..62, 75..82 (GTCTTTTT..AAAAAGAC) 33..39, 44..50 (TGTCACA..TGTGACA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 187 nt
>oriT_pSA1308
TGTCTTATTTTTGTGACAAATTCTGTATGTAGTGTCACAAAAGTGTGACATTTCGTCTTTTTATGCCCCCATGCAAAAAGACCGACGAAGTCTTGAAATATCTGGCTTTGCCAGATACCTCATCTATAGATGGGGTCATATTTTCCTTATGCTCTTACGGAGTTCTTAGAGAAAAATTGAAATTTCT
TGTCTTATTTTTGTGACAAATTCTGTATGTAGTGTCACAAAAGTGTGACATTTCGTCTTTTTATGCCCCCATGCAAAAAGACCGACGAAGTCTTGAAATATCTGGCTTTGCCAGATACCTCATCTATAGATGGGGTCATATTTTCCTTATGCTCTTACGGAGTTCTTAGAGAAAAATTGAAATTTCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 7990 | GenBank | NC_007928 |
| Plasmid name | pSA1308 | Incompatibility group | - |
| Plasmid size | 2756 bp | Coordinate of oriT [Strand] | 1042..1228 [+] |
| Host baterium | Staphylococcus aureus |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |