Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107546 |
| Name | oriT_pYF27601 |
| Organism | Yersinia frederiksenii |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_019269 (823..883 [-], 61 nt) |
| oriT length | 61 nt |
| IRs (inverted repeats) | 25..30, 44..49 (CACATC..GATGTG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 61 nt
>oriT_pYF27601
GGGTTTCGGGGCGCAGCCCTGAACCACATCATAGAGCGTTAGCGATGTGTATGCTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCACATCATAGAGCGTTAGCGATGTGTATGCTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 7981 | GenBank | NC_019269 |
| Plasmid name | pYF27601 | Incompatibility group | Col |
| Plasmid size | 5574 bp | Coordinate of oriT [Strand] | 823..883 [-] |
| Host baterium | Yersinia frederiksenii |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |