Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 107543 |
Name | oriT_pPCP |
Organism | Yersinia pestis Java 9 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NC_015055 (9620..9679 [+], 60 nt) |
oriT length | 60 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pPCP
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 7978 | GenBank | NC_015055 |
Plasmid name | pPCP | Incompatibility group | ColRNAI |
Plasmid size | 16030 bp | Coordinate of oriT [Strand] | 9620..9679 [+] |
Host baterium | Yersinia pestis Java 9 |
Cargo genes
Drug resistance gene | - |
Virulence gene | pla |
Metal resistance gene | arsH, arsR, arsB, arsC |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |