Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   107493
Name   oriT_pBERT in_silico
Organism   Salmonella enterica subsp. enterica serovar Berta
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_001848 (4389..4448 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pBERT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7928 GenBank   NC_001848
Plasmid name   pBERT Incompatibility group   ColRNAI
Plasmid size   4656 bp Coordinate of oriT [Strand]   4389..4448 [+]
Host baterium   Salmonella enterica subsp. enterica serovar Berta

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -