Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107492 |
| Name | oriT_pPAB19  |
| Organism | Salmonella enterica subsp. enterica serovar Infantis |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_019101 (2393..2449 [-], 57 nt) |
| oriT length | 57 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 57 nt
>oriT_pPAB19
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 7927 | GenBank | NC_019101 |
| Plasmid name | pPAB19 | Incompatibility group | Col440I |
| Plasmid size | 2699 bp | Coordinate of oriT [Strand] | 2393..2449 [-] |
| Host baterium | Salmonella enterica subsp. enterica serovar Infantis |
Cargo genes
| Drug resistance gene | qnrB19 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |