Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   107491
Name   oriT_pSAN2-1677 in_silico
Organism   Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1677 isolate SAN222
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP019897 (3023..3097 [-], 75 nt)
oriT length   75 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 75 nt

>oriT_pSAN2-1677
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7926 GenBank   NZ_CP019897
Plasmid name   pSAN2-1677 Incompatibility group   Col440I
Plasmid size   3126 bp Coordinate of oriT [Strand]   3023..3097 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1677 isolate SAN222

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -